Search Tenders

Tenders For antifoam

Ref No Posting Date Deadline Location Value Short Description
2222218241123 23-Nov-2024 13-Dec-2024 India / Uttar pradesh Refer Document. Tender For Wash Solution H360 50ml,Surgical Gloves No. 6.5,Distilled Water,Printer Roll,Disposal Syringe 05 ml
View Tender Detail
2237418241123 23-Nov-2024 29-Nov-2024 India / West Bengal Refer Document. Tender For Pentabromo-o-xylene greater than 99.5 percent,Tetrakis triphenylphosphine palladium 0 99.
View Tender Detail
2295118241122 22-Nov-2024 12-Dec-2024 India / Delhi Refer Document. Tender For HLA B27 SSP Low resolution typings,Hanks Buffer Salt Solution 500 ml,Lymphoprep solution,Rabbit com
View Tender Detail
2475218241122 22-Nov-2024 10-Dec-2024 India / CHHATTISGARH Refer Document. Tender For Group Conference Solution
View Tender Detail
5040918241121 21-Nov-2024 28-Nov-2024 India / Madhya Pradesh Refer Document. Tender For PT Reagent Pack,APTT Kit,Leishman stain,Drabkins solution,G6 PD test kit,CLED agar Bottle,Blood Aga
View Tender Detail
5140518241121 21-Nov-2024 11-Dec-2024 India / MADHYA PRADESH Refer Document. Tender For ANTIFOAM NON SILICONE,DE OILING POLYELECTROLYTE DOPE RO DM,ANTISCALANT pH 10 11 point 5,HIGH PH CLE
View Tender Detail
5445618241121 21-Nov-2024 24-Nov-2024 Kazakhstan KZT 188164 Tender For Purchase of motor oil, Lubricating oil (Lubricating oil High oxidation resistance Color Blue Type Universal Specialization For use in automotive electrical equipment (generators, starters, magneto) Features High oxidation resistance, Excellent mech
View Tender Detail
5934418241121 21-Nov-2024 24-Nov-2024 Kazakhstan KZT 11000 Tender For Purchase of fuels and lubricants, Liquid (Composition of the red liquid for cooling the engine: ethylene glycol (alcohol) - up to 90 %; distilled water - up to 5 %; additive package - up to 5 % (carboxylate, antifoaming, lubricating, against scale
View Tender Detail
2177318241120 20-Nov-2024 10-Dec-2024 India / Punjab Refer Document. Tender For Insulation Tape Electrical Cotton Self A,Tab Web 19 x 380 mm,Tab Web 25 x 380 mm,M Seal,Pin Cotter
View Tender Detail
1620518241119 19-Nov-2024 09-Dec-2024 India / Maharashtra Refer Document. Tender For 71.07.15.185.5 - Backup and recovery Software,71.07.10.788.5 - Hardware for backup software,- Imple
View Tender Detail
2670618241118 18-Nov-2024 09-Dec-2024 India / Rajasthan Refer Document. Tender For Cloth Dasooti cotton secured,Cloth Dasooti cotton scarlet,Chloroxylenol solution,Blade Razor safety
View Tender Detail
2426918241118 18-Nov-2024 07-Dec-2024 India / Delhi Refer Document. Tender For CI foot valve 150 mm,Non return Valve 80 mm,Ms Column Pipe 80 mm 3 mtr long with both end flanged,G
View Tender Detail
2427118241118 18-Nov-2024 07-Dec-2024 India / Delhi Refer Document. Tender For Soft Starter 75 HP,Water Meter 200 mm bore,Cl Non Return Valve 300 mm dia,MS Column Pipe 80 mm dia
View Tender Detail
285017241116 16-Nov-2024 28-Nov-2024 Brazil Refer Document. Tender For Acquisition of greases, oils, lubricants and chemical products for military use
View Tender Detail
3199017241115 15-Nov-2024 05-Dec-2024 India / Delhi Refer Document. Tender For Integrated Forensic Solution
View Tender Detail
3399217241115 15-Nov-2024 09-Dec-2024 India / Madhya Pradesh Refer Document. Tender For square angle,name plate for OC,name plate for all sections,name plate plastic,name plate nine inch
View Tender Detail
1070417241114 14-Nov-2024 04-Dec-2024 India / Madhya Pradesh Refer Document. Tender For Supply, Installation and Commissioning of Wireless Solution
View Tender Detail
1188617241114 14-Nov-2024 25-Nov-2024 India / Rajasthan Refer Document. Tender For Silicone Antifoam should be translucent, colorless, odorless, viscous liquid
View Tender Detail
1291017241114 14-Nov-2024 05-Dec-2024 India / jammu & kashmir Refer Document. Tender For Terracota,Paint Brush 6 Inch,Paint Brush 4 Inch,Fig 11 Target paper,Cricket Ball,Heatix Solution,Te
View Tender Detail
1323717241114 14-Nov-2024 04-Dec-2024 India / DELHI Refer Document. Tender For Digital Signage Solution
View Tender Detail
2714718241113 13-Nov-2024 03-Dec-2024 India / KARNATAKA Refer Document. Tender For Anti Rabbit IgG Whole molecule,Anti Guinea Pig IgG Whole molecule FITC,TPP Tissue culture flask 300
View Tender Detail
2852918241112 12-Nov-2024 25-Nov-2024 Brazil Refer Document. Tender For Acquisition of oils and lubricants
View Tender Detail
2011018241112 12-Nov-2024 02-Dec-2024 India / telangana Refer Document. Tender For Spirit Denatured,Washing Powder Super Bright EL,Paint RFU Marking Signal Red,Paint Remover Inflamma
View Tender Detail
2484118241111 11-Nov-2024 02-Dec-2024 India / Haryana Refer Document. Tender For INK BLACK OFF SET,FOUNT SOLUTION,ROLL WASH,GP PLATE WASH,RISO INK BLACK,RISO MASTER,CTP PLATE,BLANK
View Tender Detail
1551052241109 09-Nov-2024 29-Nov-2024 India / DELHI Refer Document. Tender For Cloth Dasooti Cotton Secured 91 CM
View Tender Detail
960018241108 08-Nov-2024 28-Nov-2024 India / Uttar Pradesh Refer Document. Tender For Envelope 10x14,envelope 6x12,Envelope 4x10,Mosquito Repellent Gel,Mosquito Reppelent Machine,Refill
View Tender Detail
976718241107 07-Nov-2024 27-Nov-2024 India / Madhya Pradesh Refer Document. Tender For Angle iron 5 feet,U foam 32 density,Rexine black,Packing solution,Iron thread,Bostic,Labour charge
View Tender Detail
1033318241107 07-Nov-2024 06-Dec-2024 India / rajasthan Refer Document. Tender For Chloroxlenol Solution,Handle Bamboo,Nepthalene Ball,Polythene Film point 04 mm thick x1Mtr Widt,Tap
View Tender Detail
1968052241107 07-Nov-2024 30-Nov-2024 India / HIMACHAL PRADESH Refer Document. Tender For Alt-R CRISPR-Cas9 CrRNA(DVT_ G3: TATGTAGCGCCTCTCTGCAG) , Alt-R CRISPR-Cas9 CrRNA XT , Alt-R CRISPR-Cas9 SgRNA , Alt-R CRISPR-Cas9 Tracr RNA , Alt-R S. P. HiFi-Cas9 Nuclease V3 , Nuclease Free Duplex Buffer , Nuclease Free Duplex Buffer (10x2ml) , ID
View Tender Detail
633017241106 06-Nov-2024 26-Nov-2024 India / Himachal Pradesh Refer Document. Tender For WIRE STEEL MILD 1 MM,SEAL METALLIC LEAD 10MM,CLOTH DASOOTIE ASSORTED COLOURS,CLOTH HESSAIN MEDIUM 1
View Tender Detail
3209016240422 22-Apr-2024 N/A Spain Refer Document. Tender For Supply of various reagents for treatment plants
View Tender Detail

» Our Top Clients